187. Repeated DNA Sequences

Il testo del problema è tradotto dal russo per la lingua selezionata. Il codice resta invariato.

ДНК состоит из серии нуклеотидов, обозначаемых как 'A', 'C', 'G' и 'T'.

НаEsempio, "ACGAATTCCG" — это последовательность ДНК.

При изучении ДНК полезно определять повторяющиеся последовательности внутри молекулы ДНК.

Дана stringa s, представляющая последовательность ДНК. return все последовательности длиной 10 букв (подстроки), которые встречаются более одного раза в молекуле ДНК. Ответ можно возвращать в любом порядке.

Esempio:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

Output: ["AAAAACCCCC","CCCCCAAAAA"]

C# soluzione

abbinato/originale
public class Solution {
    public IList<string> FindRepeatedDnaSequences(string s) {
        int L = 10, n = s.Length;
        if (n <= L) return new List<string>();
        int a = 4, aL = (int)Math.Pow(a, L);
        Dictionary<char, int> toInt = new Dictionary<char, int>{{'A', 0}, {'C', 1}, {'G', 2}, {'T', 3}};
        int[] nums = s.Select(c => toInt[c]).ToArray();
        int h = 0;
        HashSet<int> seen = new HashSet<int>();
        HashSet<string> output = new HashSet<string>();
        for (int start = 0; start < n - L + 1; start++) {
            if (start != 0)
                h = h * a - nums[start - 1] * aL + nums[start + L - 1];
            else
                for (int i = 0; i < L; i++)
                    h = h * a + nums[i];
            if (seen.Contains(h))
                output.Add(s.Substring(start, L));
            seen.Add(h);
        }
        return output.ToList();
    }
}

C++ soluzione

bozza automatica, rivedere prima dell'invio
#include <bits/stdc++.h>
using namespace std;

// Auto-generated C++ draft from the C# solution. Review containers, LINQ and helper types before submit.
class Solution {
public:
    public vector<string> FindRepeatedDnaSequences(string s) {
        int L = 10, n = s.size();
        if (n <= L) return new List<string>();
        int a = 4, aL = (int)Math.Pow(a, L);
        unordered_map<char, int> toInt = new unordered_map<char, int>{{'A', 0}, {'C', 1}, {'G', 2}, {'T', 3}};
        vector<int>& nums = s.Select(c => toInt[c]).ToArray();
        int h = 0;
        HashSet<int> seen = new HashSet<int>();
        HashSet<string> output = new HashSet<string>();
        for (int start = 0; start < n - L + 1; start++) {
            if (start != 0)
                h = h * a - nums[start - 1] * aL + nums[start + L - 1];
            else
                for (int i = 0; i < L; i++)
                    h = h * a + nums[i];
            if (seen.Contains(h))
                output.push_back(s.Substring(start, L));
            seen.push_back(h);
        }
        return output.ToList();
    }
}

Java soluzione

abbinato/originale
class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
        int L = 10, n = s.length();
        if (n <= L) return new ArrayList();
        int a = 4, aL = (int) Math.pow(a, L);
        Map<Character, Integer> toInt = new HashMap() {
            {
                put('A', 0);
                put('C', 1);
                put('G', 2);
                put('T', 3);
            }
        };
        int[] nums = new int[n];
        for (int i = 0; i < n; ++i) nums[i] = toInt.get(s.charAt(i));

        int h = 0;
        Set<Integer> seen = new HashSet();
        Set<String> output = new HashSet();
        for (int start = 0; start < n - L + 1; ++start) {
            if (start != 0) h = h * a -
            nums[start - 1] * aL +
            nums[start + L - 1];
            else for (int i = 0; i < L; ++i) h = h * a + nums[i];
            if (seen.contains(h)) output.add(s.substring(start, start + L));
            seen.add(h);
        }
        return new ArrayList<String>(output);
    }
}

Python soluzione

abbinato/originale
class Solution:
    def findRepeatedDnaSequences(self, s: str) -> List[str]:
        L, n = 10, len(s)
        if n <= L:
            return []
        a = 4
        aL = pow(a, L)
        to_int = {"A": 0, "C": 1, "G": 2, "T": 3}
        nums = [to_int.get(s[i]) for i in range(n)]

        h = 0
        seen, output = set(), set()
        for start in range(n - L + 1):
            if start != 0:
                h = h * a - nums[start - 1] * aL + nums[start + L - 1]
            else:
                for i in range(L):
                    h = h * a + nums[i]
            if h in seen:
                output.add(s[start : start + L])
            seen.add(h)
        return output

Algorithm

1️⃣

Перебираем начальные позиции последовательности от 1 до 𝑁−𝐿, где 𝑁 — длина строки, а 𝐿 — длина подстроки (в данном случае 10):

Если начальная позиция 𝑠𝑡𝑎𝑟𝑡==0, вычисляем хеш первой последовательности 𝑠[0:𝐿].

В противном случае вычисляем скользящий хеш из предыдущего значения хеша.

2️⃣

Проверяем хеш в хешсете:

Если хеш уже существует в хешсете, значит, мы нашли повторяющуюся последовательность, и пора обновить вывод.

В противном случае добавляем хеш в хешсет.

3️⃣

Возвращаем список вывода, содержащий все повторяющиеся последовательности.

😎

Vacancies for this task

offerte attive with overlapping task tags are mostrati.

Tutte le offerte
Non ci sono ancora offerte attive.